Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 2118412 2129205 enh11422

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 2121037 rs544754432 TGCGGGGGAGCCGAGAGGCGGGGCTGCTG T 11693

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 2121237 2123179 + AL590822.2 ENSG00000269554.1 2121237 0.65 1.0 200 59


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results