Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
---|---|---|---|---|---|
chr1 | 2118412 | 2129205 | enh11422 |
|
Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr1 | 2121037 | rs544754432 | TGCGGGGGAGCCGAGAGGCGGGGCTGCTG | T | 11693 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|---|---|---|---|---|---|---|---|---|---|---|
chr1 | 2121237 | 2123179 | + | AL590822.2 | ENSG00000269554.1 | 2121237 | 0.65 | 1.0 | 196 | 59 |
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|