| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr1 | 3016107 | 3024295 | enh26492 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr1 | 3022491 | rs142473442 | ATCCTTAGTGTGCCCCGGGGTCCACCTGTGC | A | 17066 | |
| chr1 | 3022491 | rs58028825 | ATCCTTAGTGTGCCCCGGGGTCCACCTGTGC | A | 17067 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|