| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr1 | 3144025 | 3148175 | enh92021 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr1 | 3144302 | rs370769386 | CCTCTTCAAATATCAGAAGAAAGAGGTGG | C | 19182 | |
| chr1 | 3144302 | rs374215862 | CCTCTTCAAATATCAGAAGAAAGAGGTGG | C | 19183 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|