Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 3144025 3148175 enh92021

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 3144302 rs370769386 CCTCTTCAAATATCAGAAGAAAGAGGTGG C 19182
chr1 3144302 rs374215862 CCTCTTCAAATATCAGAAGAAAGAGGTGG C 19183

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results