EnhancerDB
  1. Home
  2. TFBS
  3. PLAG1[chr1:3145047-3145061]
Chromosome characteristics of PLAG1[chr1:3145047-3145061]
Back to top
Enhancers possibly regulated by PLAG1[chr1:3145047-3145061]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 3144025 3148175 enh92021
Liver (HepG2)
SNP sites on PLAG1[chr1:3145047-3145061]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 3145049 rs139754800 C T 19205
chr1 3145050 rs74048332 G A 19206
chr1 3145055 rs530519295 AAAGGGAGCTCTGGGCCAGCCC A 19207
Genes possibly regulated by PLAG1[chr1:3145047-3145061]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by PLAG1[chr1:3145047-3145061]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results