| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr3 | 57141945 | 57148595 | enh111043 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr3 | 57142971 | rs369531439 | GGTAATGCAGACTGTCTTAGCGGTGGTCACA | G | 6756476 | |
| chr3 | 57142971 | rs537688755 | GGTAATGCAGACTGTCTTAGCGGTGGTCACA | G | 6756477 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|