Chrom Start End Enhancer ID Tissues that enhancer appears More
chr3 57141945 57148595 enh111043

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr3 57142971 rs369531439 GGTAATGCAGACTGTCTTAGCGGTGGTCACA G 6756476
chr3 57142971 rs537688755 GGTAATGCAGACTGTCTTAGCGGTGGTCACA G 6756477

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results