Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
---|---|---|---|---|---|
chr1 | 3416785 | 3420935 | enh110633 |
|
Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
---|---|---|---|---|---|---|
chr1 | 3420665 | rs558021464 | ATGGCCCCAGGGGAGGCAGAGGAGGGGGC | A | 22530 | |
chr1 | 3420671 | rs575428125 | C | A | 22531 |
Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|
Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
---|