Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 3416785 3420935 enh110633

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 3420665 rs558021464 ATGGCCCCAGGGGAGGCAGAGGAGGGGGC A 22530
chr1 3420671 rs575428125 C A 22531

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results