EnhancerDB
  1. Home
  2. TFBS
  3. PROX1[chr1:3661025-3661037]
Chromosome characteristics of PROX1[chr1:3661025-3661037]
Back to top
Enhancers possibly regulated by PROX1[chr1:3661025-3661037]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 3654605 3662241 enh42859
Muscle (Myotube) Bone (Osteoblast)
SNP sites on PROX1[chr1:3661025-3661037]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 3661027 rs372168380 AAGACTCCGTCAGAGGAGTG A 25382
chr1 3661027 rs563871602 AAGACTCCGTCAGAGGAGTG A 25383
chr1 3661034 rs149520263 C T 25384
Genes possibly regulated by PROX1[chr1:3661025-3661037]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by PROX1[chr1:3661025-3661037]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results