Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 4071545 4078980 enh15

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 4076360 rs144669861 TTCCAGCTGTTGGACTGGCAAACAG T 27222
chr1 4076360 rs373709581 TTCCAGCTGTTGGACTGGCAAACAG T 27223
chr1 4076360 rs869135063 TTCCAGCTGTTGGACTGGCAAACAG T 27224

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results