Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 5969325 5985035 enh74136

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 5977227 rs565108500 CAGGGGTGGCCCCAACCCCCACACCAAGA C 35505
chr1 5977235 rs532568047 GCC G 35506

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results