Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 6038605 6045695 enh26499

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 6039124 rs78640702 G A 35860
chr1 6039127 rs560252408 T C 35861
chr1 6039134 rs557120719 GCAGGACCCTGCCCCGGAGCTTTACCA G 35862

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results