| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr1 | 6058189 | 6066095 | enh63982 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr1 | 6059966 | rs535915424 | TGCCCTGTCTGTGCCCCGTCCGCATCCCGCCTGC | T | 36076 | |
| chr1 | 6059966 | rs59984837 | TGCCCTGTCTGTGCCCCGTCCGCATCCCGCCTGC | T | 36077 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|