Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 6286665 6290815 enh11438

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 6289865 rs562900889 CACACACACACACACACACAT C 37086
chr1 6289883 rs72632569 C T 37087

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results