EnhancerDB
  1. Home
  2. TFBS
  3. STAT1[chr1:6319953-6319968]
Chromosome characteristics of STAT1[chr1:6319953-6319968]
Back to top
Enhancers possibly regulated by STAT1[chr1:6319953-6319968]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 6315612 6319980 enh42860
Muscle (Myotube)
SNP sites on STAT1[chr1:6319953-6319968]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 6319968 rs551394352 GTCTCCTGCAGGGCACTTAAAGCCCTGTCTTCTGCTGGGAAGTT G 37316
Genes possibly regulated by STAT1[chr1:6319953-6319968]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 6307406 6321035 - GPR153 ENSG00000158292.6 6321035 0.72 0.99 1067 95
Expression level of Genes
Back to top
miRNAs possibly regulated by STAT1[chr1:6319953-6319968]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results