EnhancerDB
  1. Home
  2. TFBS
  3. MEF2A[chr1:7972245-7972255]
Chromosome characteristics of MEF2A[chr1:7972245-7972255]
Back to top
Enhancers possibly regulated by MEF2A[chr1:7972245-7972255]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 7970025 7974495 enh95829
Epithelial (MCF-7)
SNP sites on MEF2A[chr1:7972245-7972255]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 7972247 rs111946390 TTAAAATAGAGCCAAATGGC T 49708
chr1 7972247 rs60277886 TTAAAATAGAGCCAAATGGC T 49709
Genes possibly regulated by MEF2A[chr1:7972245-7972255]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by MEF2A[chr1:7972245-7972255]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results