Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 9930889 9940633 enh61788

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 9937780 rs149751788 TAACATTCTCCAGAAGACCC T 69335
chr1 9937780 rs373895006 TAACATTCTCCAGAAGACCC T 69336

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results