Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 12254319 12266475 enh11509

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 12257597 rs554592828 GGGAGCATCATCACCCCCATTTTA G 84748

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results