Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 12717085 12721235 enh90652

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 12718682 rs147245697 TCCACCCCCGGCGCTGATGCTGCCCTGCCCTG T 88054

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results