Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 14973525 14982235 enh78962

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 14981639 rs202084289 TGTGAACACTCATCTGGCCTCTG T 97669
chr1 14981639 rs374210058 TGTGAACACTCATCTGGCCTCTG T 97670

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results