Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 15629305 15633455 enh49665

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 15632272 rs376336958 CGCCTCCCACCATGATTCTGAG C 104303
chr1 15632272 rs544485610 CGCCTCCCACCATGATTCTGAG C 104304
chr1 15632283 rs74752401 A G 104305

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results