Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 15999465 16004775 enh11538

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 16003290 rs542525638 G GTGTTTCACTTATGTATATTGTT 106462

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results