| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr1 | 17024091 | 17046215 | enh11549 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr1 | 17027930 | rs2476565 | G | C | 113595 | |
| chr1 | 17027930 | rs534864027 | G | GGGAGGGGCACACACAGCCGGGAGGGACGCACACAGCCC | 113596 | |
| chr1 | 17027930 | rs58689450 | G | GGGAGGGGCACACACAGCCGGGAGGGACGCACACAGCCC | 113597 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|