Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 17460101 17470412 enh42894

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 17469494 rs146539211 GTGTATATATACACACATATACGTA G 116115
chr1 17469494 rs60387908 GTGTATATATACACACATATACGTA G 116116

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results