Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 18485005 18489275 enh11562

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 18487040 rs145323079 GTTTTCTGGTTTAAGTCATAATTTC G 122808
chr1 18487046 rs375556219 T C 122809

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results