EnhancerDB
  1. Home
  2. TFBS
  3. NFKB2[chr1:19146241-19146254]
Chromosome characteristics of NFKB2[chr1:19146241-19146254]
Back to top
Enhancers possibly regulated by NFKB2[chr1:19146241-19146254]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 19138867 19149495 enh74159
Muscle (Myoblast) Muscle (A673)
SNP sites on NFKB2[chr1:19146241-19146254]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 19146248 rs111486456 TGACCCCACAGCTAAGGGCA T 127402
chr1 19146248 rs368944946 TGACCCCACAGCTAAGGGCA T 127403
Genes possibly regulated by NFKB2[chr1:19146241-19146254]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by NFKB2[chr1:19146241-19146254]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results