Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 19904845 19910955 enh11573

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 19910094 rs139628522 TATCACCCAGGCTGAAGTGCAGTGGTGCC T 133433
chr1 19910094 rs61218681 TATCACCCAGGCTGAAGTGCAGTGGTGCC T 133434
chr1 19910095 rs377292653 A T 133435

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results