Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 22141585 22147646 enh49678

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 22145966 rs573442517 CTTTATAAATTACCTTTATAAATTTATAAA C 146897

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results