Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 23041545 23045695 enh87580

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 23043733 rs150920842 GGGCAGCAGGCCAGGCAGTTGTTGATTGT G 153831
chr1 23043733 rs368200354 GGGCAGCAGGCCAGGCAGTTGTTGATTGT G 153832

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 23046059 23046080 + hsa-miR-4684-3p MIMAT0019770 23037331 0.0 0.0 6397 20