| Chrom | Start | End | Enhancer ID | Tissues that enhancer appears | More |
|---|---|---|---|---|---|
| chr1 | 23041545 | 23045695 | enh87580 |
|
| Chrom | Position | dbSNP ID | Reference Allele | Alternative Allele | id | More |
|---|---|---|---|---|---|---|
| chr1 | 23043733 | rs150920842 | GGGCAGCAGGCCAGGCAGTTGTTGATTGT | G | 153831 | |
| chr1 | 23043733 | rs368200354 | GGGCAGCAGGCCAGGCAGTTGTTGATTGT | G | 153832 |
| Chrom | Start | End | Strand | Gene Name | Ensembl ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|
| Chrom | Start | End | strand | miRNA Name | miRBase ID | TSS | TSI of Normal tissues | TSI of Cancer tissues | Distance to TFBS | id | More |
|---|---|---|---|---|---|---|---|---|---|---|---|
| chr1 | 23046059 | 23046080 | + | hsa-miR-4684-3p | MIMAT0019770 | 23037331 | 0.0 | 0.0 | 6401 | 20 |