Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 25420205 25438395 enh26587

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 25421405 rs372276527 TTCCTTATATCATTTCACAGATACTC T 171365

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results