Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 26151305 26158275 enh11638

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 26158132 rs570931421 C CTATTTCAGGAAATAGTAAA 176361
chr1 26158134 rs528317174 A G 176362

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results