Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 31581525 31587775 enh11705

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 31584236 rs375749191 GAGCCAAGATTGCACAACTGCACTCC G 209153

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results