Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 32852365 32859275 enh90667

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 32857580 rs536755697 TAGGTATTGTTAGTATTCCCATTTTATAGATG T 218235

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 32830704 32860332 - BSDC1 ENSG00000160058.14 32860332 0.58 1.0 2746 458


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results