Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 33277945 33282115 enh87591

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 33279374 rs576722391 CATCACACATAATCTTGCTAAG C 220264

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
chr1 33240840 33283754 - YARS ENSG00000134684.6 33283754 0.8 1.0 4375 466
chr1 33282368 33324476 + S100PBP ENSG00000116497.13 33282368 0.69 0.99 2989 467


Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results