Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 34336365 34346695 enh26622

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 34336541 rs150819569 C CCAACACCCAGTGAGGAACT 224771
chr1 34336541 rs373355604 C CCAACACCCAGTGAGGAACT 224772

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results