Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 34575182 34579258 enh60111

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 34576275 rs570586539 GAACACATGGACACAAAGAGGCA G 225400

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results