EnhancerDB
  1. Home
  2. TFBS
  3. STAT3[chr1:35667916-35667927]
Chromosome characteristics of STAT3[chr1:35667916-35667927]
Back to top
Enhancers possibly regulated by STAT3[chr1:35667916-35667927]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 35664665 35670122 enh229
Pancreas (Panc1) Brain (SK-N-MC) Blood (Karpas-422)
SNP sites on STAT3[chr1:35667916-35667927]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 35667921 rs369594195 T TTGGAAAGCAAATAGCGGCATAC 228549
chr1 35667921 rs532362325 T TTGGAAAGCAAATAGCGGCATAC 228550
Genes possibly regulated by STAT3[chr1:35667916-35667927]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by STAT3[chr1:35667916-35667927]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results