EnhancerDB
  1. Home
  2. TFBS
  3. STAT2[chr1:36576088-36576103]
Chromosome characteristics of STAT2[chr1:36576088-36576103]
Back to top
Enhancers possibly regulated by STAT2[chr1:36576088-36576103]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 36571087 36580969 enh26632
Prostate (PC-3) Brain (SK-N-MC) Blood (T-cell) Astrocyte Bone (Osteoblast) Lung (PC-9) Muscle (Myoblast) Muscle (Myotube) Thymus
SNP sites on STAT2[chr1:36576088-36576103]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 36576100 rs376819303 TTCTCACCCAAGCTGGAGTGCAGTGA T 231429
chr1 36576100 rs557433893 TTCTCACCCAAGCTGGAGTGCAGTGA T 231430
Genes possibly regulated by STAT2[chr1:36576088-36576103]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by STAT2[chr1:36576088-36576103]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results