Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 37107020 37111735 enh249

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 37109744 rs531933622 GGCCACAGGCTATGCACCTGAGCA G 234946

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results