Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 41840505 41844655 enh11787

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 41841120 rs148053562 CAAGAAAGAAAGAAAGAAAGAAAGA C 260859
chr1 41841120 rs56964897 CAAGAAAGAAAGAAAGAAAGAAAGA C 260860

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results