Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 44240221 44244423 enh74198

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 44244416 rs567294317 ACGCCATTCTCCTGCCTCAG A 274999

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results