Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 44774145 44778295 enh49726

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 44776582 rs553749530 GTCTCTCTCCTCTGACCCAACTCCTTGCATGT G 278048

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results