Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 45244545 45248695 enh314

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 45248301 rs150975645 CAAATAAATAAATAAATAAAT C 281255
chr1 45248301 rs547889540 CAAATAAATAAATAAATAAAT C 281256

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results