Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 46789256 46793816 enh60124

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 46791099 rs567807549 CCCCAACTACTATTAACCTTTAGGAA C 288091

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results