Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 48230638 48236493 enh64039

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 48235625 rs147139081 C CAAGGCAGAAATCACAAGCCT 294215
chr1 48235625 rs371119513 C CAAGGCAGAAATCACAAGCCT 294216

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results