Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 48411885 48416035 enh49746

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 48413363 rs144055056 GGTCATGCAGCTAGATTTTCCAGT G 295549

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results