EnhancerDB
  1. Home
  2. TFBS
  3. FOXB1[chr1:97638797-97638808]
Chromosome characteristics of FOXB1[chr1:97638797-97638808]
Back to top
Enhancers possibly regulated by FOXB1[chr1:97638797-97638808]
Back to top
Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 97637925 97642095 enh95884
Cervix (HeLa-S3) Brain (SK-N-MC) Epithelial (MCF-7)
SNP sites on FOXB1[chr1:97638797-97638808]
Back to top
Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 97638797 rs113812521 T C 507105
chr1 97638799 rs76115794 T C 507106
chr1 97638803 rs546104123 T A,C 507107
chr1 97638805 rs531934224 CATATATGCACACATATGTACAT C 507108
Genes possibly regulated by FOXB1[chr1:97638797-97638808]
Back to top
Details of Genes
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of Genes
Back to top
No results
miRNAs possibly regulated by FOXB1[chr1:97638797-97638808]
Back to top
Details of miRNAs
Back to top
Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More
Expression level of miRNAs
Back to top
No results