Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 97637925 97642095 enh95884

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 97638803 rs546104123 T A,C 507107
chr1 97638805 rs531934224 CATATATGCACACATATGTACAT C 507108
chr1 97638814 rs138068166 A T 507109

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results