Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 110635397 110647375 enh12132

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 110642303 rs201255375 GGGAGGGGGCCGGCAGGGAGGGAGGGAA G 550837
chr1 110642304 rs80312140 G A 550838

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results