Chrom Start End Enhancer ID Tissues that enhancer appears More
chr1 110803545 110807695 enh107295

Chrom Position dbSNP ID Reference Allele Alternative Allele id More
chr1 110807578 rs140650672 CCTGTAATCTCAACTACTCGGAGG C 551718
chr1 110807578 rs373634306 CCTGTAATCTCAACTACTCGGAGG C 551719

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End Strand Gene Name Ensembl ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results

Blank TSI value indicates lack of sufficient expression for calculation
Chrom Start End strand miRNA Name miRBase ID TSS TSI of Normal tissues TSI of Cancer tissues Distance to TFBS id More

No results